Sex-Specific Dysregulation of Placental Lipid Metabolism in Preeclampsia


    Abstracting and Indexing

  • PubMed NLM
  • Google Scholar
  • Scopus
  • Web of Science
  • Semantic Scholar
  • Scilit
  • CrossRef
  • WorldCat
  • ResearchGate
  • Academic Keys
  • DRJI
  • Microsoft Academic
  • Academia.edu
  • OpenAIRE
  • Scribd
  • Baidu Scholar

Sex-Specific Dysregulation of Placental Lipid Metabolism in Preeclampsia

Jay S. Mishra1, Hanjie Zhao1, Jing Zheng2, Sathish Kumar1,2*

1Department of Comparative Biosciences, School of Veterinary Medicine, University of Wisconsin, Madison, Wisconsin, United States of America

2Department of Obstetrics and Gynecology, School of Medicine and Public Health, University of Wisconsin, Madison, Wisconsin, United States of America

*Corresponding Author: Sathish Kumar, Department of Comparative Biosciences, School of veterinary  Medicine, University of Wisconsin, Madison, Wisconsin, United States of America.

Received: 10 July 2024; Accepted: 15 July 2024; Published: 23 July 2024

Article Information

Citation:

Jay S. Mishra, Hanjie Zhao, Jing Zheng, Sathish Kumar. Sex-Specific Dysregulation of Placental Lipid Metabolism in Preeclampsia. Obstetrics and Gynecology Research. 7 (2024): 49-58.

DOI: 10.26502/ogr0159

View / Download Pdf Share at Facebook

Abstract

Background:

Preeclampsia (PE) is a hypertensive disorder of pregnancy associated with adverse maternal and fetal outcomes. While placental dysfunction is implicated in PE pathogenesis, the impact of PE on placental lipid metabolism and its potential sexual dimorphism remains poorly understood.

Methods:

We conducted a comprehensive analysis of term placentas from PE and normotensive pregnancies with male and female fetuses. Lipid profiles were quantified using mass spectrometry, and mRNA expression of genes involved in fatty acid oxidation, esterification, and transport was assessed using qPCR.

Results:

Placentas from PE pregnancies exhibited elevated lipid levels, with male placentas showing a more pronounced increase in triacylglycerols, cholesteryl esters, and free cholesterol compared to female placentas. Gene expression analysis revealed sexually dimorphic alterations, with male PE placentas exhibiting upregulation of genes involved in fatty acid uptake, oxidation, and esterification, while female PE placentas showed a more complex response with both upregulation and downregulation of certain genes. Notably, peroxisomal fatty acid oxidation was upregulated in male PE placentas but suppressed in female PE placentas.

Conclusions:

Our findings reveal sexually dimorphic alterations in placental lipid metabolism in PE, suggesting that male placentas may be more vulnerable to lipotoxicity. These insights may have implications for understanding the pathogenesis of PE and developing sex-specific interventions to improve maternal and fetal outcomes.

Keywords

<p>Preeclampsia; placental lipid metabolism; fatty acid oxidation; fatty acid esterification; fatty acid transport; fetal sex; sexual dimorphism; mitochondria; peroxisome; gene expression</p>

Article Details

Introduction

Preeclampsia (PE), a hypertensive disorder of pregnancy affecting 5-7% of American women, poses significant risks to both maternal and fetal health [1]. This disorder not only poses immediate health risks but also predisposes the offspring to a higher likelihood of neurological and cardiovascular diseases in adulthood [2]. An impaired placental function may contribute to these adverse outcomes by disrupting the supply of nutrients, such as essential fatty acids, to the fetus [3, 4]. The transfer of fatty acids from the maternal to the fetal side is a vital process [5], mediated by placental plasma membrane-associated fatty acid transport proteins (FATP) and intracellular fatty acid-binding proteins (FABPs) expressed in trophoblasts [6, 7]. PE placentas exhibit lipid accumulation, inflammation, and oxidative stress [8-10], yet fatty acid uptake is often unchanged or reduced [11-14]. This lipotoxic state may arise from altered placental fatty acid metabolism, such as increased esterification or decreased β-oxidation and transplacental transport. Gene expression analysis of PE placentas reveals downregulation of genes involved in lipid transport (FATP 1 and 4) and fatty acid elongation (fatty acid desaturase 1), while the expression of fatty acid desaturase 2 and FABP3 remains unaffected [15]. These changes in placental fatty acid metabolism may influence fetal fatty acid delivery, impacting fetal growth, fat storage, and development [4, 16].

Comparative analyses reveal a significant decrease in placental mitochondrial function and/or abundance in PE pregnancies compared to controls [17-19]. This observation, coupled with the established role of mitochondria in fatty acid oxidation [20], suggests a potential downregulation of placental β-oxidation in the context of PE. For β-oxidation to occur, long-chain fatty acids (more than 14 carbons) must first be conjugated to carnitine for import into the inner mitochondrial membrane. This process is regulated by the activity of carnitine palmitoyltransferase (CPT)1, a mitochondrial enzyme responsible for the synthesis of acylcarnitines, a key regulator of β-oxidation rates [21, 22]. While carnitine is primarily obtained through dietary intake, it can also be synthesized endogenously in the kidneys, liver, brain, and possibly in the placenta [23-25]. Fetal carnitine is thought to be derived from maternal sources via transplacental transfer [26], facilitated by the OCTN2 transporter located in the syncytiotrophoblast plasma membrane [27]. In conditions of lipid excess, peroxisomes can contribute to fatty acid oxidation by shortening long-chain fatty acids, bypassing the CPT1 requirement for mitochondrial entry [28]. Peroxisome proliferation is induced by elevated lipid levels [29], suggesting a role for these organelles in PE and hyperlipidemic states, although their activity in PE placentas remains unclear.

Emerging evidence suggests sex-specific fetal responses to adverse intrauterine conditions result in differential susceptibility to metabolic diseases later in life [30]. Furthermore, placental function and response to maternal factors may vary depending on fetal sex. Rodent models have demonstrated sex-specific adaptations in placental development in response to maternal nutrition [31]. Similarly, human placentas exhibit sex-based differences in size and gene expression throughout gestation, potentially contributing to distinct intrauterine growth patterns [32, 33]. Recent research has highlighted sexual dimorphism in placental mitochondrial respiration, particularly in the utilization of glutamine, fatty acids, and glucose. Notably, placentas from obese women with gestational diabetes mellitus showed increased reliance on glucose and fatty acids for baseline respiration and reduced metabolic flexibility in utilizing these substrates, exclusively in male fetuses [34]. These findings underscore the importance of considering fetal sex in understanding the complex interplay between maternal health, placental function, and fetal development [34].

The intricate interplay between placental fatty acid metabolism, oxidation capacity, and their impact on transport to the fetus remains poorly characterized, particularly in PE pregnancies. We postulate that PE differentially affects placental lipid metabolism, fatty acid oxidation, and transport mechanisms based on fetal sex. To investigate this hypothesis, we conducted a comprehensive analysis of term placentas from both male and female offspring of PE and normotensive pregnancies. This analysis encompassed lipid quantification and gene expression profiling of enzymes and transporters involved in fatty acid oxidation, esterification, and lipid transport.

Methods

Placenta Sample Collection

All procedures were conducted in accordance with the Declaration of Helsinki. Pregnant women were enrolled to donate their placenta under a protocol approved by the Institutional Review Board at the University of Wisconsin, Madison (Protocol # 2018-006). All participants gave informed written consent for sample collection and the use of their protected health information. PE was defined according to standard American College of Obstetricians and Gynecologists criteria [35]. All PE patients included in this study had late-onset mild PE without major fetal morbidity. To avoid the stress of labor, only c-section-delivered placentas were used. Placental tissue was collected from the maternal face of the placenta, avoiding under-perfused or calcified cotyledons. Several full-depth samples were collected randomly across the surface of the placenta from multiple cotyledons. Chorionic membranes and maternal decidua layers were removed, and large villous samples were further dissected into small pieces that were blotted for removal of blood and separately snap frozen in liquid nitrogen within 5 minutes of biopsy.

Placental lipid analysis

Lipid extraction

Frozen placental tissues (20-30 mg) were used for the extraction and spiked with 10 μL of an internal standard and calibration mixture consisting of 500 picomoles/μL of di-myristoyl phospholipids (phosphatidyl glycerol, phosphatidyl ethanolamine, phosphatidyl serine, phosphatidic acid), phosphatidylcholine (46:0), sphingomyelin (30:1), ceramide (30:1) and triacylglycerol (15:0). To each sample, 300 μL of -20 °C chilled 75% methanol containing 1 mM butylated hydroxytoluene (BHT) was added and samples were homogenized in a Fisher Scientific bead mill using ceramic beads. Then, one mL of MTBE was added to each sample, and samples were then vortexed for 60 minutes at room temperature. 250 μL of water and 75 μL of methanol were added, and the samples were vortexed for an additional 15 minutes and then centrifuged for 15 minutes. The supernatants were collected in new test tubes, and precipitated proteins were re-extracted as above. Pooled extracts were dried overnight in a speed vac and resuspended in 500 μL of isopropanol containing 0.01% BHT.

Mass Spectrometry

Immediately prior to analysis, aliquots of each lipid extract were diluted in isopropanol: methanol (2:1, v: v) containing 20 mM ammonium formate. Full scan MS spectra at 100,000 resolutions (defined at m/z 400) were collected on an LTQ-Orbitrap Velos mass spectrometer (Thermo Scientific, Waltham, MA) in both negative and positive ionization modes. Scans were collected from m/z 200 to m/z 1200. For each analysis, 10 μL of sample was directly introduced by flow injection (no LC column) at 10 μL/min using an electrospray ionization source equipped with a heated ESI needle. A Shimadzu Prominance HPLC (Shimadzu Corporation, Carlsbad, CA) served as the sample delivery unit. The sample and injection solvent were 2:1 (v: v) isopropanol: methanol containing 20 mM ammonium formate. The spray voltage was 4.5 kV, ion transfer tube temperature was 275 °C, the S-lens value was 50 percent, and the ion trap fill time was 100 ms. The autosampler was set to 15 °C. After two minutes of MS signal averaging, the LC tubing, autosampler, and ESI source were flushed with 1 mL of isopropanol prior to injection of the next sample. Samples were analyzed in random order, interspersed by blank injections. Following MS data acquisition, offline mass recalibration was performed with the "Recalibrate Offline" tool in Thermo Xcalibur software (Waltham, MA) according to the vendor's instructions, using the theoretical computed masses for the internal calibration standards and several common endogenous mammalian lipid species. MS/MS confirmation and structural analysis of lipid species identified by database searching were performed using higher-energy collisional dissociation (HCD) MS/MS at 60,000 resolution and a normalized collision energy of 25 for positive ion mode and 60 for negative ion mode. MS/MS scans were triggered by inclusion lists generated separately for positive and negative ionization modes.

Lipid Peak Finding, Identification, and Quantitation

Lipids were identified using the Lipid Mass Spectrum Analysis (LIMSA) v.1.0 software linear fit algorithm for automated peak finding and correction of 13C isotope effects. Peak areas of found peaks were quantified by normalization against an internal standard of a similar lipid class. The top ~300 most abundant peaks in both negative and positive ionization modes were then chosen for MS/MS inclusion lists and imported into Xcalibur software (Waltham, MA, USA) for structural analysis on a pooled sample as described above.

Placental gene expression analysis by quantitative polymerase chain reaction

Total RNA was obtained following homogenization of ∼40 mg placental tissue in TRIzol reagent (Invitrogen, Waltham, MA), followed by cleanup using the RNeasy mini kit (QIAGEN, Valencia, CA) following the manufacturer's instructions. The integrity and concentrations of RNA were determined with DS-11 spectrophotometer (DeNovix, Wilmington, DE). Synthesis of cDNA was done with 1 μg of RNA with an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). After dilution, cDNA corresponding to 20 ng of RNA was amplified by using a CFX96 real-time thermal cycler (Bio-Rad), and a SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Primer sequences are shown in Table 1. The 2-ΔΔCT method was used for analysis, and data was expressed as the fold change of the gene of interest in experimental versus control samples. All reactions were performed in duplicate, with GAPDH used as an internal control.

Table 1. Quantitative real-time PCR primer sequence.

Gene Name

Forward Primer

Reverse Primer

CD36

CAGGTCAACCTATTGGTCAAGCC

GCCTTCTCATCACCAATGGTCC

FATP1

TGACAGTCGTCCTCCGCAAGAA

CTTCAGCAGGTAGCGGCAGATC

FATP2

GTGGAGAAAGATGAACCTGTCCG

CTGAGCCTTTGCTCCAGCATAG

FATP4

GGACCAACTTTTCCAGCCGCTT

TGCGGCTATTGAAACCACAGGC

FATP6

AGCCACCATGTTGTCTCACTCC

ACCAAAAGCCCACAGGACAGCA

FABP3

GTGGAGTTCGATGAGACAACAGC

TGGTCTCTTGCCCGTCCCATTT

FABP4

ACGAGAGGATGATAAACTGGTGG

GCGAACTTCAGTCCAGGTCAAC

FABP5

GGTGCATTGGTTCAGCATCAGG

TCATAGATCCGAGTACAGGTGAC

PPARγ

TCTAAAGAGCCTGCGAAAGC

GCTTGTAGCAGGTTGTCTTG

SRBP1C

GTTGGTGCTCGTCTCCTTGG

GCAGGTGACGGATGAGGTTC

ACCa

GATGTGAGCCTGCGGAATAG

AACTGCTGCCATCATAGGAC

FAS

AGATGGCTTGCTGGAGAACC

AGTTGCTCTGTCCCGCATTG

SCD

GGTTTCACTTGGAGGTGTGG

TTGATGTGCCAGCGGTACT

DGAT1

TCCTTGAGATGCTGTTCTTC

CCAGTAGAAGAAGATGAGCC

PLIN2

GATGGCAGAGAACGGTGTGAAG

CAGGCATAGGTATTGGCAACTGC

CytB

CCAACATCTCCGCATGATGAAAC

TGAGTAGCCTCCTCAGATTC

PPARα

TTTCTGTCGGGATGTCACAC

TCTTCAAGTAGGCCTCGTAG

ACDVL

TTGGCAGTGCTCTAAAGAAT

GCAGCAGAAACTGTTCATTG

CPT1b

CGTTCCTGTACCACGAGTC

GAAGAGGTGCCTGTCGATCC

CACT

TCCCAGCTAGTGGAATGTAT

CCCTTTGTACAAGGATGTGA

CPT2

AAACCCTCACTATTGACTGC

CACTCAACCATCATCTGCT

OCTN2

GACCATATCAGTGGGCTATTT

CTGCATGAAGAGAAGGACAC

PEX3

ACCAGAGGACTTGCAATATG

TACAGCCACAGTACTTCTTG

DBP

ATTGTAACACCATTGCTCCT

CCCAGCGTAATTTTCCAATC

COT

TCACCCGGATACGTTTATTC

CGATCAAATCCTTTTCCAGC

GAPDH

GTCTCCTCTGACTTCAACAGCG

ACCACCCTGTTGCTGTAGCCAA

Statistical Analyses

Data are presented as mean ± standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism (GraphPad Software, Boston, MA). Comparisons between PE and control groups within each fetal sex were conducted using Student's t-test, following confirmation of normality assumptions by the Shapiro-Wilk test. Statistical significance was defined as p < 0.05.

Results

Maternal Characteristics

Table 2 depicts maternal demographics in the study population. There are no significant differences in maternal body mass index (BMI) or maternal age between normotensive control and PE groups in both male and female fetuses. However, gestational age is significantly lower in PE groups compared to control groups for both male and female fetuses. As expected, systolic and diastolic blood pressure are significantly higher in PE groups compared to normotensive control groups for both male and female fetuses. Fetal weight does not differ significantly between normotensive control and PE groups in either male or female fetuses. The PE groups show a protein/creatinine ratio greater than 0.3. All patients are Caucasians with no current or past history of other major complications.

Table 2: Maternal demographics in the study population

Population characteristics

Male

Female

Control

PE

p-value

Control

PE

p-value

Maternal BMI

24.1 ± 1.6

25.8 ± 1.3

NS

23.9 ± 0.7

24.9 ± 1.3

NS

Maternal age (years)

30.2 ± 1.0

28.9 ± 1.4

NS

33.7 ± 2.2

31.9 ± 2.1

NS

Gestational age (weeks)

39.3 ± 0.6

37.2 ± 0.2

< 0.05

39.4 ± 0.3

37.4 ± 0.8

< 0.05

Fetal Weight (grams)

3401 ± 121

2910.3 ± 161

NS

3473.5 ± 107.1

2831 ± 248.1

NS

Systolic BP (mmHg)

112.1 ± 3.2

141 ± 1.2

< 0.05

109.2 ± 2.1

150.4 ± 4.1

< 0.05

Diastolic BP (mmHg)

75.6 ± 3.4

95.4 ± 2.3

< 0.05

70.0 ± 3.2

90.8 ± 5.1

< 0.05

Protein/creatinine ratio (mg/ml)

NA

> 0.3

NA

> 0.3

PE – preeclampsia; BMI – body mass index; BP- blood pressure; n=20 for each group.

Placental Lipid Quantification

Analysis of placental lipid levels in PE and control pregnancies revealed significant differences based on fetal sex. In male PE placentas, total triacylglycerol, cholesteryl esters, and free cholesterol are significantly higher compared to male control placentas (Table 3). Female PE placentas only showed a significant increase in free cholesterol compared to female control placentas, with no significant changes in total triacylglycerol and cholesteryl esters (Table 3). Additionally, phosphatidylcholine, sphingomyelin, phospholipids, and ceramides are significantly lower in male PE placentas compared to male control placentas, while no differences were observed in female placentas (Table 3).

Table 3: Quantitative comparison of class total lipid profiles in placenta (ng/mg tissue).

Lipid Class

Male

Female

Control

PE

p-value

Control

PE

p-value

Triacylglycerol

210.85 ± 23.97

526.99 ± 109.95

< 0.05

210.08 ± 18.84

437.19 ± 163.39

NS

Cholesteryl Esters

71.57 ± 13.05

164.17 ± 34.05

< 0.05

52.26 ± 5.56

125.54 ± 31.30

NS

Free Cholesterol

8.69 ± 0.73

17.80 ± 2.24

< 0.05

7.37 ± 0.35

17.13 ± 4.96

< 0.05

Phosphatidylcholine

4333.82 ± 325.47

2002.37 ± 337.05

< 0.05

3749.67 ± 523.17

3251.36 ± 200.18

NS

Phosphatidylethanolamine

3504.87 ± 310.28

2303.73 ± 709.90

NS

3091.43 ± 440.05

4230.95 ± 166.27

NS

Phosphatidylserine

101.82 ± 14.08

84.25 ± 14.11

NS

92.28 ± 20.71

114.75 ± 11.22

NS

Sphingomyelin

3779 ± 98.97

2092.61 ± 333.61

< 0.05

3081.58 ± 247.76

3125.12 ± 264.54

NS

Phospholipids

8148.01 ± 658.75

4488.99 ± 1048.66

< 0.05

7136.89 ± 982.28

7806.97 ± 371.15

NS

Ceramide

82.15 ± 9.42

35.31 ± 8.57

< 0.05

67.71 ± 6.60

73.89 ± 6.61

NS

PE – preeclampsia; n=20 for each group.

Placental Fatty Acid Transport Gene Expression

In male PE placentas, there is a significant increase in the mRNA expression of CD36, FATP1, FATP2, FATP4, FATP6, FABP3, and FABP4 compared to male control placentas. In contrast, the mRNA expression of FABP5 does not significantly differ between male PE and control placentas (Figure 1A). In female PE placentas, there is a significant increase in FATP1 and FABP4 mRNA expression compared to female control placentas. However, a significant decrease was observed in CD36, FATP2, and FATP6 mRNA expression in female PE placentas compared to female control placentas. The mRNA expression of FABP3 and FABP5 does not differ significantly between female PE and control placentas (Figure 1B).

fortune-biomass-feedstock

Figure 1: Effect of preeclampsia on placental fatty acid uptake and transport in (A) male and (B) female placentas. mRNA expression of placental genes involved in fatty acid uptake and transport was assessed in 20 placentas in each sex in normotensive (NT) control and preeclampsia (PE) groups. Data (means ± SEM) are presented as the ratio of the target gene to the reference gene GAPDH. *p<0.05 compared to respective NT controls.

Placental Lipid Esterification Gene Expression

In male PE placentas, there is a significant increase in the mRNA expression of PPARγ, ACC, FAS, DGAT1, and PLIN2 compared to male control placentas. In contrast, the mRNA expression of SRBP1c and SCD does not significantly differ between male PE and control placentas (Figure 2A). In female PE placentas, there is only a significant increase in DGAT1 and PLIN2 mRNA expression compared to female control placentas. However, a significant decrease is observed in ACC mRNA expression in female PE placentas compared to female control placentas. The mRNA expression of PPARγ, SRBP1c, FAS, and SCD does not differ significantly between female PE and control placentas (Figure 2B).

fortune-biomass-feedstock

Figure 2: Effect of preeclampsia on the placental lipid esterification pathway in (A) male and (B) female placentas. mRNA expression of placental genes involved in lipid esterification was assessed in 20 placentas in each sex in normotensive (NT) control and preeclampsia (PE) groups. Data (means ± SEM) are presented as the ratio of the target gene to the reference gene GAPDH. *p<0.05 compared to respective NT controls.

Placental Fatty Acid Oxidation Gene Expression

In male PE placentas, there is a significant increase in the mRNA expression of Cytb, PPARα, ACDVL, CPT1b, DBP and COT compared to male control placentas. In contrast, the mRNA expression of CACT, CPT2, OCTN2 and PEX3 does not significantly differ between male PE and control placentas (Figure 3A). In female PE placentas, there is only a significant increase in the mRNA expression of ACDVL and CPT1b compared to female control placentas. However, a significant decrease was observed in PEX3 and DBP mRNA expression in female PE placentas compared to female control placentas. The mRNA expression of Cytb, PPARα, CACT, CPT2, OCTN2, and COT does not differ significantly between female PE and control placentas (Figure 3B).

fortune-biomass-feedstock

Figure 3: Effect of preeclampsia on the placental fatty acid oxidation pathway in (A) male and (B) female placentas. mRNA expression of placental genes involved in fatty acid oxidation was assessed in 20 placentas in each sex in normotensive (NT) control and preeclampsia (PE) groups. Data (means ± SEM) are presented as the ratio of the target gene to the reference gene GAPDH. Mitochondrial number was estimated by the ratio of CytB/β-actin DNA. *p<0.05 compared to respective NT controls.

Discussion

Placental lipid metabolism is essential for maintaining proper placental function, ensuring positive pregnancy outcomes, and supporting healthy fetal growth [30, 36]. To our knowledge, this is the first comprehensive investigation of the transcriptomic changes in enzymes involved in fatty acid oxidation and esterification, lipid transporters, and lipid content within placental tissue in the context of PE. Our study reveals a striking sexual dimorphism in the impact of PE on placental lipid metabolism. Specifically, we observed elevated levels of placental triacylglycerol and cholesteryl esters in pregnancies with male fetuses, accompanied by increased expression of genes involved in fatty acid esterification, β-oxidation, and transport. In contrast, pregnancies with female fetuses did not exhibit significant alterations in triacylglycerol and cholesteryl ester levels, and fewer lipid metabolism genes were affected.

Consistent with previous studies [8, 37, 38], our data demonstrates elevated placental lipid content in PE pregnancies compared to controls. Notably, we observed a sex-specific effect, with male PE placentas exhibiting a more pronounced lipid accumulation than female PE placentas. Specifically, triacylglycerols, cholesteryl esters, and free cholesterol were significantly higher in male PE placentas compared to their respective controls. In contrast, only free cholesterol was significantly elevated in female PE placentas compared to controls. Previous studies have also reported increased placental lipid content in PE, although fetal sex was not considered [8]. The abundance of transport proteins at the maternal-placental interface highlights its importance in regulating fatty acid uptake into the placenta. Several membrane transporters, including CD36 (fatty acid translocase) and FATPs (fatty acid transport proteins 1-6), are implicated in placental fatty acid uptake [39]. Once within the trophoblast, fatty acid-binding proteins (FABPs) facilitate intracellular transport to mitochondria for oxidation, to organelles for esterification and storage, or to the fetal-facing trophoblast membrane for fetal delivery [40]. While our data shows upregulation of fatty acid uptake gene expression (CD36, FATP1, FATP2, FATP4, FATP6) in male PE placentas, this was not observed in female PE placentas, which instead showed downregulation of CD36, FATP2, and FATP6 and upregulation of only FATP1. Previous reports [38, 41], without consideration of fetal sex, have shown decreased CD36 and increased FATP1 mRNA expression in term PE placentas. However, we observed upregulation of major intracellular fatty acid carriers FABP3 and FABP4 in male PE placentas and FABP4 in female PE placentas. Consistently, Yan et al. reported that placental FABP4 mRNA expression is higher in placentas of PE women compared to controls, but the sex of the placenta is not reported [42]. Our findings suggest increased placental uptake in male, but not female, PE placentas. However, the upregulation of intracellular fatty acid carriers FABP3 and FABP4 in male PE placentas and FABP4 in female PE placentas indicates augmented intracellular fatty acid trafficking in both sexes in PE pregnancies.

Our data supports the notion that the upregulation of key proteins in the lipid esterification pathway may direct fatty acids toward storage in PE placentas. This is particularly evident in male PE placentas, where we observed a significant increase in the expression of PPARγ, a master regulator of lipid esterification and storage [43-45]. This upregulation of PPARγ could be a response to elevated placental fatty acid concentrations, potentially stemming from increased placental uptake [46]. Although this mechanism requires further investigation in placental tissue, similar findings have been reported in adipose and hepatic tissues of mice and non-pregnant individuals [43, 45]. Notably, in a mouse model, rosiglitazone-induced placental PPARγ activation increased placental fatty acid uptake but decreased transfer to the fetus due to enhanced lipid storage [43]. PPARγ is known to stimulate the transcription of ACC, FAS, DGAT1, and other key genes involved in lipid esterification and storage [44, 47, 48]. Consistently, the increased expression of PPARγ in male PE placentas was accompanied by a significant upregulation of ACC and FAS, key enzymes involved in de novo lipogenesis [49]. This suggests that increased fatty acid uptake may lead to enhanced fatty acid synthesis in male PE placentas. Moreover, the upregulation of DGAT1 and PLIN2, genes involved in triacylglycerol synthesis [48] and lipid droplet formation [50], respectively, further supports the idea of increased lipid storage in these placentas. In contrast, female PE placentas did not exhibit such a pronounced upregulation of lipid esterification genes. While DGAT1 and PLIN2 were upregulated, ACC was downregulated, suggesting a less active de novo lipogenesis pathway compared to male PE placentas. This observation aligns with the lack of significant changes in triacylglycerol and cholesterol ester levels in female PE placentas. These findings highlight a sex-specific effect of PE on placental lipid metabolism, with male placentas exhibiting a greater propensity for lipid accumulation through enhanced fatty acid uptake, synthesis, and storage. The upregulation of PPARγ in male PE placentas may be a key driver of this process, and further investigation into the mechanisms underlying this phenomenon is warranted.

In addition to influencing tissue fatty acid content and availability for esterification and storage, placental fatty acid oxidation provides ATP essential for critical functions such as hormone synthesis, which regulates maternal adaptations to pregnancy and parturition [51-53]. In male PE placentas, there is a significant upregulation of key genes involved in mitochondrial fatty acid oxidation, including CPT1b (the rate-limiting enzyme) [54, 55], its positive regulator PPARα [56], and ACDVL, which catalyzes the first step of mitochondrial fatty acid β-oxidation. This is accompanied by an increase in Cytb, a marker of mitochondrial number, suggesting a potential compensatory mechanism to enhance overall oxidation capacity in response to the increased lipid load observed in PE. Furthermore, in male PE placentas, we observe upregulation of DBP and COT, key components of the peroxisomal β-oxidation machinery. This could indicate an increased reliance on peroxisomal fatty acid oxidation in response to the excess fatty acid accumulation in PE, as peroxisomes can oxidize shorter fatty acids that bypass the CPT1b to enter mitochondria through diffusion to maintain overall β-oxidation capacity [29, 57, 58]. However, this compensatory mechanism may have detrimental effects due to the generation of hydrogen peroxide, a reactive oxygen species that can damage mitochondria if not adequately scavenged by antioxidants [59, 60]. Interestingly, female PE placentas show a different response, with only CPT1b and ACDVL being upregulated. The downregulation of PEX3, a regulator of peroxisome biogenesis and integrity, and DBP, suggests a suppression of peroxisomal fatty acid oxidation in female PE placentas. This sexually dimorphic response in peroxisomal activity may contribute to the differential susceptibility of male and female fetuses to the adverse effects of PE. These findings align with previous studies reporting increased expression of fatty acid oxidation-related genes in PE animal models and PE [61, 62], although other studies have shown decreased expression [38, 63]. Our findings highlight the complex and sexually dimorphic regulation of placental fatty acid oxidation in PE. The upregulation of mitochondrial and peroxisomal oxidation pathways in male placentas, coupled with the increase in mitochondrial number, suggests a compensatory mechanism to handle excess fatty acids, albeit with potentially negative consequences due to increased oxidative stress. In contrast, the suppression of peroxisomal oxidation in female placentas may reflect a different adaptive strategy to PE.

In conclusion, our study demonstrates a marked sexual dimorphism in placental lipid metabolism in PE, with male fetuses exhibiting greater susceptibility to dysregulated fatty acid oxidation, esterification, and transport compared to female fetuses (Figure 4). These findings underscore the importance of considering fetal sex in future research on PE, as it may reveal novel insights into the underlying mechanisms and potential therapeutic targets. However, it is important to note that our study is limited to the analysis of term placentas, and further prospective studies are needed to investigate protein expression and activity of enzymes/transporters and the developmental trajectory of these alterations throughout gestation. Additionally, future studies should also assess lipid levels in maternal and fetal tissues or plasma to gain a more comprehensive understanding of the interplay between placental lipid metabolism, fetal development, and long-term health outcomes. Ultimately, this line of research may contribute to the development of personalized interventions for PE based on fetal sex and contribute to a deeper understanding of the placenta's role in shaping offspring health.

fortune-biomass-feedstock

Figure 4: Schematic summarizing sexually dimorphic alterations in placental lipid metabolism in PE. In male placentas, preeclampsia (PE) upregulates fatty acid (FA) transport, β-oxidation, and esterification, leading to increased triacylglycerol (TG) and cholesterol ester (CE) accumulation. In contrast, female placentas exhibit a more complex response, with altered expression of fatty acid transport and oxidation genes, but no significant changes in TG and CE levels. These findings suggest that male placentas may be more vulnerable to the lipotoxic effects of PE. Red arrows – Upregulated; Blue arrows – Downregulated.

Author Contributions

J.M. and H.Z. contributed to the conception and design of the study, conducted the experiments and data analysis, and wrote the initial draft of the manuscript. J.Z. provided critical intellectual contributions and revised the manuscript. S.K. conceived the study, secured funding, provided critical intellectual contributions, and revised the manuscript. All authors have read and approved the final manuscript.

Funding

This research was funded by the National Institutes of Health (NIH) through grant R01HL134779 awarded to S.K. The findings and conclusions presented in this manuscript are those of the authors and do not necessarily reflect the official views or policies of the NIH. The funding agency had no involvement in the study design, data analysis, or interpretation of results.

Data Availability

All data are incorporated into the article and are available upon request.

Declarations of Conflict of Interest

The authors declare no conflicts of interest.

References:

  1. Rana S, Lemoine E, Granger JP, et al. Preeclampsia: Pathophysiology, Challenges, and Perspectives. Circ Res 124 (2019): 1094-1112.
  2. Liu D, Gao Q, Wang Y, et al. Placental dysfunction: The core mechanism for poor neurodevelopmental outcomes in the offspring of preeclampsia pregnancies. Placenta 126 (2022): 224-232.
  3. Jahan F, Vasam G, Green AE, et al. Placental Mitochondrial Function and Dysfunction in Preeclampsia. Int J Mol Sci (2023): 1-22.
  4. Perazzolo S, Hirschmugl B, Wadsack C, et al. The influence of placental metabolism on fatty acid transfer to the fetus. J Lipid Res 58 (2017): 443-454.
  5. Al MD, van Houwelingen AC, Kester AD, et al. Maternal essential fatty acid patterns during normal pregnancy and their relationship to the neonatal essential fatty acid status. Br J Nutr 74 (1995): 55-68.
  6. Larque E, Krauss-Etschmann S, Campoy C, et al. Docosahexaenoic acid supply in pregnancy affects placental expression of fatty acid transport proteins. Am J Clin Nutr 84 (2006): 853-861.
  7. Dutta-Roy AK. Transport mechanisms for long-chain polyunsaturated fatty acids in the human placenta. Am J Clin Nutr 71 (2000): 315S-322S.
  8. Brown SH, Eather SR, Freeman DJ, et al. A Lipidomic Analysis of Placenta in Preeclampsia: Evidence for Lipid Storage. PLoS One 11 (2016): e0163972; 1-13.
  9. Borzychowski AM, Sargent IL, Redman CW. Inflammation and pre-eclampsia. Semin Fetal Neonatal Med 11 (2006): 309-316.
  10. Raijmakers MT, Dechend R, Poston L. Oxidative stress and preeclampsia: rationale for antioxidant clinical trials. Hypertension 44 (2004): 374-380.
  11. Hu M, Li J, Baker PN, et al. Revisiting preeclampsia: a metabolic disorder of the placenta. FEBS J 289 (2022): 336-354.
  12. Rani A, Chavan-Gautam P, Mehendale S, et al. Differential regional fatty acid distribution in normotensive and preeclampsia placenta. BBA Clin 4 (2015): 21-26.
  13. Mackay VA, Huda SS, Stewart FM, Tham K, McKenna LA, Martin I, Jordan F, Brown EA, Hodson L, Greer IA, Meyer BJ, Freeman DJ. Preeclampsia is associated with compromised maternal synthesis of long-chain polyunsaturated fatty acids, leading to offspring deficiency. Hypertension 60 (2012): 1078-1085.
  14. Kulkarni AV, Mehendale SS, Yadav HR, et al. Reduced placental docosahexaenoic acid levels associated with increased levels of sFlt-1 in preeclampsia. Prostaglandins Leukot Essent Fatty Acids 84 (2011): 51-55.
  15. Wadhwani N, Patil V, Pisal H, et al. Altered maternal proportions of long chain polyunsaturated fatty acids and their transport leads to disturbed fetal stores in preeclampsia. Prostaglandins Leukot Essent Fatty Acids 91 (2014): 21-30.
  16. Calabuig-Navarro V, Puchowicz M, Glazebrook P, et al. Effect of omega-3 supplementation on placental lipid metabolism in overweight and obese women. Am J Clin Nutr 103 (2016):1064-1072.
  17. Hu XQ, Zhang L. Mitochondrial Dysfunction in the Pathogenesis of Preeclampsia. Curr Hypertens Rep 24 (2022): 157-172.
  18. Vaka R, Deer E, Cunningham M, et al. Characterization of Mitochondrial Bioenergetics in Preeclampsia. J Clin Med 10 (2021): 1-13.
  19. Vangrieken P, Al-Nasiry S, Bast A, Leermakers PA, et al. Placental Mitochondrial Abnormalities in Preeclampsia. Reprod Sci 28 (2021): 2186-2199.
  20. Mendez-Figueroa H, Chien EK, Ji H, et al. Effects of labor on placental fatty acid beta oxidation. J Matern Fetal Neonatal Med 26 (2013): 150-154.
  21. Flanagan JL, Simmons PA, Vehige J, et al. Role of carnitine in disease. Nutr Metab (Lond) 7 (2010): 1-14.
  22. Sharma S, Black SM. Carnitine Homeostasis, Mitochondrial Function, and Cardiovascular Disease. Drug Discov Today Dis Mech 6 (2009): e31-e39.
  23. Cave MC, Hurt RT, Frazier TH, et al. Obesity, inflammation, and the potential application of pharmaconutrition. Nutr Clin Pract 23 (2008): 16-34.
  24. Oey NA, van Vlies N, Wijburg FA, et al. L-carnitine is synthesized in the human fetal-placental unit: potential roles in placental and fetal metabolism. Placenta 27 (2006): 841-846.
  25. Vaz FM, Wanders RJ. Carnitine biosynthesis in mammals. Biochem J 361 (2002): 417-429.
  26. Arenas J, Rubio JC, Martin MA, et al. Biological roles of L-carnitine in perinatal metabolism. Early Hum Dev 53 (1998): S43-50.
  27. Grube M, Meyer Zu Schwabedissen H, Draber K, et al. Expression, localization, and function of the carnitine transporter octn2 (slc22a5) in human placenta. Drug Metab Dispos 33 (2005): 31-37.
  28. Wanders RJ, Waterham HR, Ferdinandusse S. Metabolic Interplay between Peroxisomes and Other Subcellular Organelles Including Mitochondria and the Endoplasmic Reticulum. Front Cell Dev Biol 83 (2015): 1-15.
  29. Smith JJ, Aitchison JD. Peroxisomes take shape. Nat Rev Mol Cell Biol 14 (2013): 803-817.
  30. Myatt L, Maloyan A. Obesity and Placental Function. Semin Reprod Med 34 (2016): 42-49.
  31. Mao J, Zhang X, Sieli PT, et al. Contrasting effects of different maternal diets on sexually dimorphic gene expression in the murine placenta. Proc Natl Acad Sci USA 107 (2010): 5557-5562.
  32. Buckberry S, Bianco-Miotto T, Bent SJ, et al. Integrative transcriptome meta-analysis reveals widespread sex-biased gene expression at the human fetal-maternal interface. Mol Hum Reprod 20 (2014): 810-819.
  33. Clifton VL. Review: Sex and the human placenta: mediating differential strategies of fetal growth and survival. Placenta 31 (2010): S33-39.
  34. Wang Y, Bucher M, Myatt L. Use of Glucose, Glutamine, and Fatty Acids for Trophoblast Respiration in Lean Women, Women With Obesity, and Women With Gestational Diabetes. J Clin Endocrinol Metab 104 (2019): 4178-4187.
  35. Hypertension in pregnancy. Report of the American College of Obstetricians and Gynecologists' Task Force on Hypertension in Pregnancy. Obstet Gynecol 122 (2013): 1122-1131.
  36. Desoye G, Shafrir E. Placental metabolism and its regulation in health and diabetes. Mol Aspects Med 15 (1994): 505-682.
  37. Williams IM, Albertolle ME, Layden AJ, et al. Lipidomics Reveals Elevated Plasmalogens in Women with Obesity Who Develop Preeclampsia. J Clin Med 12 (2023): 1-14.
  38. Khaire AA, Thakar SR, Wagh GN, et al. Placental lipid metabolism in preeclampsia. J Hypertens 39 (2021): 127-134.
  39. Duttaroy AK, Basak S. Maternal Fatty Acid Metabolism in Pregnancy and Its Consequences in the Feto-Placental Development. Front Physiol 12 (2021): 1-16.
  40. Haggarty P. Placental regulation of fatty acid delivery and its effect on fetal growth--a review. Placenta 23 (2002): S28-38.
  41. Rani A, Chavan-Gautam P, Mehendale S, et al. Region-specific changes in the mRNA and protein expression of LCPUFA biosynthesis enzymes and transporters in the placentae of women with preeclampsia. Placenta 95 (2020): 33-43.
  42. Yan Y, Peng H, Wang P, et al. Increased expression of fatty acid binding protein 4 in preeclamptic Placenta and its relevance to preeclampsia. Placenta 39 (2016): 94-100.
  43. Schaiff WT, Knapp FF, Jr., Barak Y, et al. Ligand-activated peroxisome proliferator activated receptor gamma alters placental morphology and placental fatty acid uptake in mice. Endocrinology 148 (2007): 3625-3634.
  44. Schaiff WT, Bildirici I, Cheong M, et al. Peroxisome proliferator-activated receptor-gamma and retinoid X receptor signaling regulate fatty acid uptake by primary human placental trophoblasts. J Clin Endocrinol Metab 90 (2005): 4267-4275.
  45. Ferre P. The biology of peroxisome proliferator-activated receptors: relationship with lipid metabolism and insulin sensitivity. Diabetes 53 (2004): S43-50.
  46. Lindsay KL, Hellmuth C, Uhl O, et al. Longitudinal Metabolomic Profiling of Amino Acids and Lipids across Healthy Pregnancy. PLoS One 10 (2015): e0145794; 1-19.
  47. Bechmann LP, Hannivoort RA, Gerken G, et al. The interaction of hepatic lipid and glucose metabolism in liver diseases. J Hepatol 56 (2012): 952-964.
  48. Yen CL, Stone SJ, Koliwad S, et al. Thematic review series: glycerolipids. DGAT enzymes and triacylglycerol biosynthesis. J Lipid Res 49 (2008): 2283-2301.
  49. Proenca AR, Sertie RA, Oliveira AC, et al. New concepts in white adipose tissue physiology. Braz J Med Biol Res 47 (2014): 192-205.
  50. Pathmaperuma AN, Mana P, Cheung SN, et al. Fatty acids alter glycerolipid metabolism and induce lipid droplet formation, syncytialisation and cytokine production in human trophoblasts with minimal glucose effect or interaction. Placenta 31 (2010): 230-239.
  51. Mouzon SH, Lassance L. Endocrine and metabolic adaptations to pregnancy; impact of obesity. Horm Mol Biol Clin Investig 24 (2015): 65-72.
  52. Lassance L, Haghiac M, Minium J, et al. Obesity-induced down-regulation of the mitochondrial translocator protein (TSPO) impairs placental steroid production. J Clin Endocrinol Metab 100 (2015): E11-18.
  53. Shekhawat P, Bennett MJ, Sadovsky Y, et al. Human placenta metabolizes fatty acids: implications for fetal fatty acid oxidation disorders and maternal liver diseases. Am J Physiol Endocrinol Metab 284 (2003): E1098-1105.
  54. Visiedo F, Bugatto F, Sanchez V, et al. High glucose levels reduce fatty acid oxidation and increase triglyceride accumulation in human placenta. Am J Physiol Endocrinol Metab 305 (2013): E205-212.
  55. Sebastian D, Guitart M, Garcia-Martinez C, et al. Novel role of FATP1 in mitochondrial fatty acid oxidation in skeletal muscle cells. J Lipid Res 50 (2009): 1789-1799.
  56. Feingold KR, Wang Y, Moser A, et al. LPS decreases fatty acid oxidation and nuclear hormone receptors in the kidney. J Lipid Res 49 (2008): 2179-2187.
  57. Le Borgne F DJ. Interaction between peroxisomes and mitochondria in fatty acid metabolism. Open J Mol Integr Physiol 2 (2012): 27-33.
  58. Huang T-Y ZD, Muller-Borer B, Collins M, et al. Peroxisomal biogenesis occurs in response to obesity and to a high lipid environment in human skeletal muscle. FASEB J (abstract 1159.5) 28 (2014).
  59. Mele J, Muralimanoharan S, Maloyan A, et al. Impaired mitochondrial function in human placenta with increased maternal adiposity. Am J Physiol Endocrinol Metab 307 (2014): E419-425.
  60. Saben J, Lindsey F, Zhong Y, et al. Maternal obesity is associated with a lipotoxic placental environment. Placenta 35 (2014): 171-177.
  61. Sato E, Tsunokuni Y, Kaneko M, et al. Metabolomics of a mouse model of preeclampsia induced by overexpressing soluble fms-like tyrosine kinase 1. Biochem Biophys Res Commun 527 (2020): 1064-1071.
  62. Shin EK, Kang HY, Yang H, et al. The Regulation of Fatty Acid Oxidation in Human Preeclampsia. Reprod Sci 23 (2016): 1422-1433.
  63. Abascal-Saiz A, Fuente-Luelmo E, Haro M, et al. Decreased Fatty Acid Oxidation Gene Expression in Pre-Eclampsia According to the Onset and Presence of Intrauterine Growth Restriction. Nutrients 15 (2023): 1-18.

Article Views: 4060

Journal Statistics

Impact Factor: * 3.6

Acceptance Rate: 76.63%

Time to first decision: 10.4 days

Time from article received to acceptance: 2-3 weeks

Discover More: Recent Articles

Grant Support Articles

© 2016-2026, Copyrights Fortune Journals. All Rights Reserved!